What sequence do you look for before alpha amylase gene?
His 6 box (tag) CATCATCATCATCAT
TBlastx
translate genes to proteins, to find similarities in order to find proteins which are related to Bacillus subtillus- which is the strain we isolated alpha amylase from
If interested to find mutations or specific 'things'
add more primers to finish sequencing
check for all of amino acids, some can show silent mutations
Why start with Chromas
to find a good sequence and manage it and translate to protein to check for your gene, in order to check for quality
Transformation (E. coli BL21)
use of different concentration of proteins, keeping all characteristics otherwise they wont work
DE3
respective strains contain ^DE3 lysogen that carries the gene for T7 RNA polymerase under control of the lacUV5 promoter
Super repression (& of T7RNA polymerase)
to express gene when we want, not at rate of bacteria
over expression of gene makes proteins toxic, which is why we want to modulate expression by different concentrations of protein (high solubility)
IPTG
required to maximally induce expression of the T7 RNA polymerase in order to express recombinant genes cloned downstream of a T7 promoter
Plating of transformation
Using the recombinant strain provided (BL21+ plasmid) as inoculumand drop 5 microliter of cell suspension in the center of plates
Without amp
strain will kick plasmid out
Culture media
LB, ampi, starch, glucose (full catabolic repression, supresses alpha amylase) or IPTG
Starch
substrate of alpha amylase (endoamylase digests from inside releasing maltose, exoamylase digests from outside releasing glucose) alpha 1,4 (glucoamylase 1,6)
Gratuitous(free) Inducer IPTG
analogue
binds to active site
*cell cant use it, will not be used as carbon source
Starch and Iodine Complex
ramification point 1,6 and rest is alpha 1,4
iodine gets in helix and releases blue color, also depends on amylopection
purple to red color=high amylopectin/dextrin content
Where to introduce proteins
in exponential phase where there is balanced growth (no restriction, huge amounts of nutrients, OD600=0.5) max at 17 C, at 37 C there are inclusion bodies and improper folding
Native gels
(preserve the protein activity, checking mass)
measure halos and graph (negative slope)
recover agar and place in -20C for 30 min
centrifuge and remove supernatant
native gel (active protein)
Denaturing gels
(checking molecular weight)
centrifuge 30 mL of induced cells (BL21 E. coli)
lyse cells with BPERII
centrifuge to separate protein pellet and supernatant
transfer supernatant to denaturing gel and toss pellet
Staining plates
adding iodine and slowly spread out solution to see halo, use a ruler to measure diameter to compare glucose vs. IPTG
When added glucose and IPTG
we should have no hydrolysis, and have huge amount of protein which....
at 500, there is a small halo which results from this
Factors affecting hydrolysis
agar concentrations of the plates need to be precise to not have halo error, but autoclaving affects this precision
Breakdown E. coli
2 solutions- BPERII added to lyse cells
Dextrin Limit
...
Native Buffer
glycerol, blue dye, and tris buffer
keeps the structure of the enzyme
Why gel didn't work
amylo- starch was too thick to pass through
ex. picture: larger fragment would be alpha amylase
Must check
molecular weight and placement in gel before purification
Homogenizer
uses different pulses because the heat will break cells and protein
French press
opening the chamber to different pressure will make the cells 'blow up'
Blue resin in spin column
sepharose bead (agarose beads) which will allow for the attachment of nickel so imidazole will out compete His
How to eliminate nickel
clip His tag by using protease, can also be eluted by adjusting the pH
How to check for proteins
using bradford media which turned blue when positive
Why boil the sample
to denature the protein confirmation of hydrogen bonds and protect them from reestablishing bonds
Protein charge
amphoteric
coated in SDS to keep them linear and coat them in negative charge to run in gel
PAGE analysis groups
molecular weight marker, raw protein extract (sample), flow through (non sticky protein), wash (non sticky protein), eluate (purified protein)
Western blot
transfer of protein onto membrane, solute concentration super important,
uses antibodies to detect proteins
Flow of western blot (important steps)
electrophoresis of protein sample> transfer proteins from gel to nitrocellulose paper> detecting bound antibody by horseradish peroxidase anti Ig conjugate and formation of a diaminobenzidine (DAB) precipitate
Antibody
reacts with HIStag, must identifiy to maximize degredation
Blotting membrane
nitrocellulose
*PVDF
nylon (DNA)
DBM
DPT
What to do after transfer
check reactivity and molecular weight of membrane product
Detection
primary antibody recognizes target protein, the secondary antibody recognizes the primary (enzyme conjugate) and fluoresces after the enzyme substrate is added
IPTG is used in this kind of assays because_____
It will induce the expression of the T7 RNA polymerase to transcribe the target gene.
Which of the following data bases should we use to analyze a DNA fragment?
BLASTn
Select the line that follows the basic FASTA format used in bioinformatics.
>SeqA atgatgatgatcgctgctagataga
>SeqX PATKAKPCSSCTKT
>Seq2 augcucgacagauacagauagac
The T7 polymerase is an E. coli native gene.
False
Why can you include other carbon sources (like starch in our case) in plates where recombinant strains will be plated?
to better identify recombinants with a second genetic marker
In the E. coli BL21 strain used in our assays the T7 RNA polymerase is encoded in:
the lamda lysogenic region called DE3
How long are the sequenced fragments using the classical Sanger method?
500 to 700 bp
The efficiency of the transformation is higher when the strains are transformed with supercoiled plasmids. We did the transformation of DH5-alpha with a ligation mixture containing recombinant plasmids by using the LIC system. After that, the plasmids wer
Most of the plasmids recovered will be in the supercoiled form, we expect higher efficiency of transformation.
What is FASTA format in bioinformatics?
Text-based format for representing sequences.
Why it is necessary manually analyze your sequencing results?
To correct mistakes
Because automatic annotations usually include errors
To select the best part of the sequence, usually at the beginning of the run is not accurate
In E. coli BL21 there is an optimal OD600 to induce the expression of genes using the p15TV-L (as well as many of the pET plasmids). We know that the cells at such OD values are precisely in the middle of the exponential growth phase, usually called "bala
0.5
Can you please identify the sentence that best describes balanced growth?
When in a bacteria population, the concentration of all cellular components increases at the same rate during growth under constant environmental conditions
Why is IPTG called a gratuitous inducer?
Because it cannot be used for the cells as a carbon source
Which of the following best describes the form of the amylose chain around the iodine once it has formed a complex with starch?
Helix
Which of the following phases is the best to induce the recombinant proteins?
Exponential phase
IPTG behave like a natural inducer because it is similar to_______
1,6-allolactose
Which of the following methods can be used as alternative to the iodine test to evaluate the amylolytic activity?
Quantification of glucose released
Quantification of oligosaccharides released
IPTG interacts with_________?
LacI repressor
How many growth phases can we easily recognize while bacteria is growing in a batch culture?
4
The blue color of the iodine amylose complex turns red-ish once the ____________ content is high.
Amylopectin or dextrin
IMAC elution: Which of the following compounds was used as competitive eluent?
Imidazole
Which of the following methods is used to disrupt bacterial cells for protein purification?
French press
Ultrasound
Protein extraction reagent
Which of the following methods used to disrupt bacteria cell for protein purification is more suitable to be used in large scale?
French Press
IMAC protocol can be used to purify proteins in their native state as well as under denaturing conditions.
True
Which of the following compounds can replace nickel in IMAC resins?
Cobalt
Which of the following lines correctly describe the sequence used in IMAC?
cell lysis - binding - washing - elution
The poly-histidine Tag usually consist of 4 to 6 histidine residues. How many histidine residues interact per molecule of nickel attached to the agarose beads?
It is 2 (His) to 1 (Ni++) interaction
How many steps were described in the IMAC protocol used in the lab?
4
IMAC elution: Which of the following methods can be used to elute the protein attached to the Ni++ column?
Competitive elution
Stripping
pH adjustment
Which of the following metals is attached to the agarose beads used in the columns for protein purification?
Nickel
Reducing compounds are used to ___________ the disulfide bonds after the protein is denatured.
Reduce
Keeping the disulfide bonds fully reduced will minimize the protein________
Refolding
We describe all protein as being AMPHOTERIC. Why do proteins run to the cathode during PAGE?
Because they are denatured and in complex with SDS resulting in a negative net charge
Why is Laemmli buffer is used in PAGE?
To visualize the samples with the blue color
To facilitate the gel load using glycerol, increasing the density
To denature the protein samples
Usually, because it is easier and fast, we denature protein by boiling the samples in Laemmli buffer. But, we can also use alternative methods. Which of the following methods can also be used to denature proteins?
High urea concentration
Which of the following components of Laemmli buffer help in protein denaturation?
?-mercaptoethanol
The PAGE is composed of two portions with differences in gel matrix. This two portions are called ________ and _____________.
Stacking and resolving
Why should the protein samples be boiled?
To denature proteins
A fully denatured proteolytic enzyme was used as sample in a denaturing PAGE (with SDS and DTT). It is possible to use that protein embedded in the gel matrix to evaluate its catalytic activity?
no
When proteins are treated with SDS and a reducing agent they are fully denatured and with negative charge. This trick allow us to separate protein according to____________.
Mass
Which of the following methods are useful to measure the enzymatic hydrolysis of starch?
Quantification of reducing sugars
Quantification of glucose released
Quantification of residual starch with iodine method
Which of the following industrial problems can be solved with the use of alpha amylase?
Poor starch slurry homogeneity
Where is it possible to find high amounts of alpha amylase in the human body?
Saliva
Pancreas
What is the specific name of the alpha amylase produced in human and animal saliva?
Ptyalin
alpha-amylase is classified as:
Endoglucanase Endoamylase
Alpha-glucanase
Which of the following steps during the industrial use of starch is alpha-amylase dependent?
Starch slurry liquefaction
Production of high glucose syrup
Production of high maltose syrup
Based on the characteristics observed in our laboratory test, which of the following starches will have the highest concentration of amylopectin?
Cassava
Identify the correct definition of an enzyme unit.
One U is the amount of the enzyme that catalyzes the conversion of 1 micro-mole of substrate per minute
Starch solubility depends on:
The relationship between the amylose/amylopectin
Which combination of enzymes will generate the highest amount of free D-glucose from starch?
Alpha amylase and glucoamylase
Which of the following experiments should be studied using western blotting techniques?
Beta-actin presence in cell free extracts
Northern Blot
study gene expression by detection of RNA
Western Blot
use antibodies to detect proteins
Southern Blot
detection of DNA specific sequences in DNA sampled
Eastern Blot
identification of protein posttranslational modifications
Which of the following criteria is critical to select the best immobilization membrane?
The nature of the biological sample to be immobilized
Which of the following are the most relevant/descriptive steps of western blot technique?
Separation of protein sample - transfer to the membrane -detection of the bound antibody
Which of the following patterns will better described the distribution of the layers in the western blot sandwich?
sponge
filter paper
pvdf membrane
gel
filter paper
sponge
5 components of western detection
membrane> target> primary antibody> secondary antibody> detection signal (activated by enzyme substrate)
Which of the following membranes is NOT used to transfer proteins to be analyzed by western blot?
Hemicellulose
The blocking step generally used in blotting technique is useful to:
Minimize background coloration
The use of monoclonal antibodies in western blot is recommended because:
the high specificity of the antibody
The quantification of proteins in western blot is:
Relative, using internal standards included in the same membrane